An and stable transfection. Lentiviral vectors are considered

An
optimized method for overexpression (Lentiviral Transduction) of specific genes
in Human Adipose-Derived Mesenchymal Stem Cells

 

Zohreh Bolandi1, 2……………..….Hossein
Ghanbarian1, 2*

1Cellular and Molecular Biology Research
Center, Shahid Beheshti University of
Medical Sciences, Tehran, Iran

2Department of
Biotechnology, School of Advanced Technologies in Medicine, Shahid Beheshti
University of Medical Sciences, Tehran, Iran

 

 

 

* Corresponding author:

Hossein Ghanbarian, PhD

Biotechnology Department

School of Advanced Technologies in Medicine

Shahid Beheshti University of Medical Sciences

Tehran, Iran

Phone: +98 9125996305

Fax:     +98 21 22439956

E-mail: [email protected]

 

 

 

 

ABSTRACT

 

Key words:

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

INTRODUCTION:

Mesenchymal
stem cells (MSCs) are multipotent plastic-adherent cells that isolated from
many adult tissues such as adipose, bone marrow, muscle, and umbilical blood.
There is no specific surface marker for MSCs characterization but they are
distinguished from hematopoietic stem cells by expressing of CD73, CD90 and,
CD105 but the absence of CD14, CD31, CD34, and CD45. MSCs can be differentiated
into mesoderm lineages, namely adipocytes, osteoblasts, and chondrocytes.
Furthermore, it has been shown these cells have the ability to differentiate
into cardiomyocytes, myocytes, hepatocytes, and neural cells. Due to this
unique property, MSCs are widely used for gene. For this purpose, MSCs were
isolated from adipose tissue, owing to its accessibility and minimal
invasiveness, and then gene of interest was transferred to the cells by viral
or nonviral methods. Most of the nonviral transfection methods (e.g.;
electroporation, lipofection) have a low efficiency (%??) in transfection of
primary cells, however viral transfection gives rise to more efficient (up to??
%) and stable transfection.

Lentiviral
vectors are considered as an efficient vehicle to express exogenous genes in
MSCs. The current standard method for efficient long-term lentiviral
transduction needs the concentration of virus particles from a large amount of
culture media. One method to achieve this is ultracentrifugation that requires
expensive specialized laboratory equipment that is a major drawback in
viral transduction. If the procedure were optimized, the cells could be
transfected with supernatant directly.

Moreover, it
has been well established that polybrene increase viral transduction efficiency
due to its positive charge which reduce negative charges between viral and
target cell surface. Nevertheless recent studies revealed that polybrene can
decrease MSC proliferation and this issue is a major drawback especially in
gene therapy, where we needs sufficient cells from
patient (proliferationPARANDCO1  )…… Recent studies showed that liposomalPARANDCO2  component could increase transduction
efficiency of viral vectors by encapsulation of whole negatively charged viral
particles and introduce them to the cell surface because of positive charges.
The object of this study was to evaluate optimized method for stably
transfection of AD-MSCs with lentiviral vector without using ultracentrifuge
and polybrene.

2. MATERIALS
AND METHODS:

2.1
Isolation and expansion of human Adipose-derived mesenchymal stem cells:

Adipose tissues
were obtained from healthy adult donors undergoing plastic surgery at Taleghani
hospital according to procedures approved by the
Ethics Committee at the Shahid Beheshti University of Medical Sciences.
MSCs were isolated as described previously (ref). Briefly to obtain hAD-MSCs,
adipose tissues were minced into small pieces and then digested with 0.075%
collagenase type I (Gibco) 20 min at 37 ºC under continuous shaking. The
digested samples were neutralized with Dulbecco modified Eagle medium (DMEM)
containing 10% fetal bovine serum (FBS). After centrifugation at 400g for 10
min, pellets were suspended and cultured in MSCs complete medium, DMEM
supplemented with 10% FBS and 100 U/ml penicillin/streptomycin, and maintained
in a humidified atmosphere of 5% CO2 at 37 °C. After 24 hrs, nonadherent cells
were washed and culture medium was changed with fresh one. Every 3-4 days 50%
medium was changed with fresh media. When cells reached to optimum confluency,
they trypsinized and passed to new culture flasks. For following experiments
the cells were used at passage 3.

2.2
Evaluation of MSCs differentiation:

To
confirm that the isolated cells were multipotent, we tested cultures at passage
3 for their ability to undergo differentiation into adipocytes and osteocytes.

·        
Adipogenesis:
For adipogenic differentiation MSCs cultured at a density of 3×104
cells/well in 4-well tissue culture plates and next day medium was changed with
adipogenic induction medium that containing 5 mM insulin (Sigma-Aldrich), 250
nM dexamethasone (Sigma-Aldrich), 100 mM indomethacin (Sigma-Aldrich) and 0.5
mM 3-isobutyl-1-methylxanthine (Sigma- Aldrich). Medium was changed every 3
days. Approximately, after 21 days, cultures were fixed using formalin solution and Successful differentiation was evaluated by detecting
intracellular lipid deposits by Oil Red O staining. Control MSCs cultures were
grown in MSCs complete medium.

·        
Osteogenesis:
The osteogenic differentiation of MSCs was performed by seeding 3×104
cells/well in 4-well tissue culture plates in complete medium. The following
day, osteogenic medium containing 10mM ?-glycero phosphate (Merck), 50µM ascorbic acid
biphosphate (Sigma), and 100nM dexamethasone (Sigma) was added. Medium was replaced every 3 days. At day 21, the cells
were fixed using formalin
solution and osteoblastic differentiation was confirmed by Alizarin red
S-staining. Control MSCs cultures were grown in MSCs complete medium.

2.3 Flow
cytometric analysis of human Adipose-derived mesenchymal stem cells:

For Flow
cytometric analysis of hAD-MSCs surface markers, the Confluent cells were
trypsinized at passage 3 and washed twice with PBS, then the cells were
incubated at 4ºC for 40 minutes in the dark with the monoclonal antibodies
conjugated with fluorescein isothiocyanate (FITC) or phycoerythrin (PE)
including: CD45, CD11b, CD73, CD105, and CD34. Related isotype antibodies were
used as the control (All antibodies were purchased from eBioscience, USA). The
labled cells were analyzed using a FACSCalibur
flow cytometer (Becton Dickinson, FACScan, San Jose, CA, USA), and data
analysis was performed using Flowjo 7.6.1.

2.4
Construction of Recombinant Vector Harboring Target Gene

In this study
we choosed hsa-miR-29b1 as the target gene. In order to produce stable
transgenic hAD-MSC, we used pLenti-III-miR-GFP (ABM, Canada)  vector (ABM, Canada) that target genes were
expressed under a CMV promoter and have eGFP for fluorescent tagging and
puromycin for selecting stable transgenic AD-MSCs. Human pre-miR-29b1 flanked
by ?100
bp on either end was PCR-amplified from genomic DNA using gene-specific primers. Forward and reverse
primers contained XhoI and NotI site,
respectivly (the underlined nucleotides show the restriction sites used for
cloning) F: CCGCTCGAGTGAACCTTTGTCTGGGCAAC, R: TTTTCCTTTTGCGGCCGCAGACCTGACTGCCATTTGTG. The fragment was then cloned into pLenti-III-GFP at XhoI and Not I site according to standard
digestion-ligation method. (Or The PCR products were
cloned into T vector………….). We verified
the pLenti-III-miR-29b1-GFP construct by digestion and subsequent DNA
sequencing. pLenti-III-GFP was used as control vector.

2.5
Lentivirus packaging or Lentivirus construction
and production or virus Production or Retrovirus production and
infection

To produce the lentiviruses,
4×106 HEK293T were plated in T-75 plastic cell culture flasks in DMEM
medium supplemented with 10% FBS, and incubated 24 h to reach the confluency of
approximately 80%. 2-3 h prior to transfection medium was replaced with 10 ml DMEM
medium with 5% FBS. Calcium phosphate method was used to co-transfection of
HEK293T with transfer vector and helper plasmids; psPAX2 (Addgene, Cambridge, MA)
and pMD2.G (Addgene, Cambridge, MA). with the ratio of
2:2:1. All solutions were prewarmed, mixed and agitated before use. The transfection conditions for a T75 flask were the
following: 21 µg transfer vector, 21 µg psPAX2 and 10.5 µg pMD2.G were added to
33 µl TE 1X, 105 µl CaCl2 (2.5M) and mix up to a total volume of 1050 µl with
water. The mixture was then vortexed while 1050 µl of 2X HBSS buffer (HEPES 50 mM,
NaCl 280 mM, Na2HPO4 0.75 mM, NaH2Po4•2H2O 0.75 mM, pH 7.05) was added dropwise.
Transfection solution incubated for 15 minutes at room temperature and added to
HEK293T cells. The cells were incubated in 5% CO2 incubator at 37?C. After 16 h
medium was changed by 7 ml fresh DMEM with 5% FBS. Supernatants were collected
every 24 h, centrifuged at 500×g for 5 min at 4?C, followed by filtered through
a 0.45µm pore size filter to remove cell debris (Millipore). The viruses were
utilized freshly or aliquted and stored at -80°C.

2.6
Transduction of MSCs

hAD-MSCs were
cultured at density of 1×105 cells/ T-25 plastic cell culture flasks
in DMEM supplemented with 10% FBS and expanded at 37°C and 5% CO2 overnight to
reach the 30% confluency. To perform transduction culture medium was changed
with 3 mL fresh virus supernatant that collected the same day in the presence
of 4 µg/ml polybrene (Sigma). On the next day, transduction was repeated by
replacing of supernatant with another 3 mL of fresh one. After 24 hours, cells
were washed and cultured in complete media containing 10 % FBS for additional day.
Control cell samples were subject to the same
manipulations without adding a virus supernatant or none transduced cells that were
cultured in DMEM plus 10% FBS with 4 µg/ml Polybrene were used as
control group. 48 hrs later the transduction
efficiency was analyzed by fluorescence microscopy and
GFP-positive cells were then assessed by flow cytometry.

2.7 Flow
cytometry Analysis of transduction efficiency or transgene
expression????

In
order to analysis of Transduction efficiency, transduced and control cells were
trypsinized. After inactivation, cells were washed and resuspended
in PBS and GFP expression were analysed by flow cytometry or FACSCalibur flow cytometer (Becton Dickinson,
FACScan, San Jose, CA, USA), and data analysis was performed using Cyflogic
software (CyFlo Ltd).

2.8
RNA extraction and Quantitative RT-PCR or Reverse
Transcription Polymerase Chain Reaction
or qRT-PCR or RNA
extraction and cDNA synthesis:

Fourty eight
hours after transduction, cells were collected and total RNA was extracted using
Trizol reagent (Life Technologies, USA) according to manufacturer instructions.
After measurment of RNA concentrations by NanoDrop 2000 (Thermo Fisher
Scientific, USA), 1 µg of RNA was reverse-transcribed to cDNA using MMLV
reverse transcriptase (Fermentas) and stem loop miR-specific RT primer for
hsa-miR-29b1 (????? ???????). Quantitative real-time RT-PCR was
performed in triplicates on an ABI Step one System
using SYBR green master mix (Amplicon). The following conditions was carried
out: an initial incubation 15 min at 95 ?C, followed by 20 s at 95 ?C and 1 min
at 60 ?C for 40 cycles. All expression were normalized to U47 as the endogenous
reference gene. Relative expression was calculated using 2-??ct (or
REST 2009).

2.10
Statistical Analysis.

All experiments
were performed in triplicates otherwise stated. Statistical analyses were
evaluated using Microsoft Excel, version 2013 and one-way analysis of variance
(ANOVA) using GraphPad Prism 7 program. The difference was considered
significant at p < 0.05.             3. RESULTS: 3.1 Morphological and differential characteristics of hAD-MSCs: We isolated human MSCs from adipose tissues collected from healthy donor using enzymatic digestion. Non-adherent cells were washed 24 hrs after primary culture and adherent cells were expanded until 90% confluency. Morphological analysis using a light microscopoy evaluated that the isolated adherent cells possess spindle fibroblast-like shape (Fig. 1a). Furthermore, to investigate the multipotent potential of the cells, we cultured the cells in osteogenic and adipogenic induction media at passage 3. After 21 days, Oil red O staining of cytoplasmic oil droplets, indicated that MSCs successfully differentiated into adipocytes (Fig. 1b) and calcium deposits of osteocytes were detected using Alizarin red S (Fig. 1c). 3.2 Flow cytometric (Surface antigens) characterization of hAD-MSCs: At passage 3, MSCs isolated from human adipose tissues were trypsinized after reaching 90% confluency, produce single cells and examined by flow cytometry for MSCs surface antigens. The isolated cells were positive for MSCs surface markers, CD90, CD73, CD29, CD105, CD73, CD140b, CD146 and CD166, however epithelial and hematopoietic cell markers, CD11b, CD31, CD34 and CD45 were not expressed on the cells (Fig. 2). 3.3 Packaging and transfer vectors or Lentiviral construct and recombinant viral particle production: To overexpression of the target gene in hAD-MSCs, we initially cloned hsa-miR-29b1 precursor into pLenti-III-miR-GFP vector with XhoI and NotI digestion. PCR amplification using vector universal primers, restriction endonuclease digestions, and finally DNA sequencing of fragment confirmed that cloning was successful (Fig 3a, b, c). We next produced viral particles by cotransfection of transfer vector with helper vector (psPAX2, pMD2.G) to HEK293T. The transfection efficiency was ~90% (Fig. 4). Every 24 hrs supernatants that contained virus particles were collected. 3.4 High transduction efficiency of Mesenchymal stem cells through modification of culturing conditions: Since lentiviral transduction of primary cells is technically challenging, and need some equipment like ultarcentrifuge to prepare the virus particles, here we change the transduction conditions for efficient transduction as following: we were seeded hAD-MSCs at 30% confluency in T-25 plastic cell culture flaskes (Fig. 5a) and cultured them with 4 ml of freshly collected virus supernatant in presence of 4 µg/ml polybrene. 24 hrs later the same procedure was repeated and let to rest then for one day. After 24-48 hrs the cells were examined by fluorescence microscopy and flow cytometry. They demonstrarted that more than 90% of cells were transduced with desired vector (Fig. 5b). 3.5 Flow (GFP)?? 3.6 Target gene expression in transduced adipose derive mesenchymal stem Cells: To further (investigate) confirmation of lentiviral transduction of human adipose derived mesenchymal stem cells, total RNA was extracted from these cells and Real-time RT-PCR assay was performed utilizing U47 as a control. Results revealed significant overexpression of mature has-miR-29b in transduced cells compared to that of control groups that transduced with backbone lentiviral vector as control (Fig. 6).               4. DISCUSSION: Although recently MSCs have an increasing attention in gene therapy, However, It has been challenging to transfer of exogenous genes into the primary cells (ref). Lentiviral vectors are one of the efficient transfection vehicles for stably integration of target genes into the genome of both dividing and nondividing cells, but these method needs to concentrate the viruses and purification of viral particles by ultracentrifugation that could be an instrumental barrier in the transduction process because of heavy cost on laboratories (ref). Currently, several optimized methods have been described to transduce MSCs with or without using ultracentrifugation (ref). Optimization of transduction can be achieve by several condition including the use of appropriate viral vectors, improve viral concentration, initial target cells confluency (or number), transduction over multiple days and, use of positively charged component to introduce the virus to target cell membrane (ref). Despite many studies have been conducted to achieve different protocols to transfer gene into MSCs, they usually use another equipment and chemical reagent that cause more charge on researchers (ref). So the aim of the current study was to develop an alternative efficient and simple method to transduce primary adipose derived-mesenchymal stem cells, significantly without needs to concentration of the virus particles. In this regards, we decreased virus culture medium to obtain more concentrated viruses and also confluency of MSCs decreased to 30% at the transduction time. For increase in transduction efficiency polybrene commonly was added to viral particles (ref), but numerous studies have shown that polybrene can influence MSCs proliferation (ref). So here, we used 5 µl lipofectamine 2000 as positive charged chemical component to reduce negative repulsion between the cell membrane and lentiviruses, without decrease in transduction efficiency. These data are in contract with the observations of Hodgson and et, al, who studied the effect of liposomes on retroviral transduction.1 Di Nicola et al and Zhang et al also used lipofectamine reagent for increase transduction of primary T lymphocytes (ref) To sum up, the data presented here show that our modified method could transduce AD-MSCs 48 hours post transduction and the efficiency was more than 90% and our work develop a simple method to introduce exogenous gene into adipose derived mesenchymal stem cells without using expensive equipment and proliferation inhibitor. 5. ACKNOWLEDGMENTS This work was supported by research grants of Shahid Beheshti University of Medical Sciences, Tehran, Iran. We would like to thank Ms. Ameneh Kouchaki for technical assistance.   6. CONFLICT OF INTEREST There are neither ethical nor financial conflicts of interest involved in the manuscript.                           7. REFERENCES:                                     FIGURE LEGENDS Figure 1: Morphology and differentiation ability of adipose derived-mesenchymal stem cells (AD-MSCs) Morphology of human AD-MSCs by light microscopy at passage 2 (20×) showed fibroblast-like cells (A). After 21 days, adipogenic differentiation were assessed by Oil red O staining of oil droplets (B), and osteogenic differentiation were verified by staining of calcium deposits with Alizarin Red (C). Figure 2: Flow cytometric analysis of adipose derived-mesenchymal stem cells (AD-MSCs) surface phenotypic markers 106 cells were stained with FITC or PE-labeled monoclonal antibodies to human CD45, CD11b, CD73, CD105, and CD34. Red and blue histograms displayed isotype control antibodies labeling and surface proteins, respectively. Data are shown as the mean±SD. Figure 3: Figure 4: Transfection of 293T producer cell line HEK 293T cells were transfected with plenti-III-miR-GFP and helper plasmid to produce viruses.  16 hours after transfection the cells were examined by Light microscopy (A), and fluorescent microscopy (B). GFP expression revealed that the rate of transfection was more than 90%. Figure 5: Transduction of adipocyte-derived mesenchymal stem cells (AD-MSCs) by lentiviruses. Panel A shows AD-MSCs prior to transduction and Panel B shows transduced AD-MSCs by pCDH-CMV-p28-IRES-EBI3-EF1-copGFP-Pur lentiviral vector. The numerous green cells and GFP expression indicate a high level of transduction The comparison of transfection efficiency of mesen- chymal stem cells using various medium conditions. The green fluorescence protein expression was evaluated at 24 h post- transfection, (40× magnification) Figure 6: Expression of mature miR-29b in lentiviral transduced adipose derived-mesenchymal stem cells. The mature level of miR-29b was examined in MSCs isolated from adipose tissue by qPCR assay. (n=4 each). Data are mean ±S.E.M. *p<0.05, ***p <0.001.  PARANDCO1In addition to the increased cost of transducing MSCs, the inhibition of MSC proliferation is problematic for any therapy that requires sufficient cells to repopulate a host  PARANDCO2In addition, this study implied that Lipofectamine is a superb additive to enhance the transduction efficiency of a retrovirus via a specific virus envelope protein-receptor interaction for virus entry, and that receptor-mediated endocytosis does not seem to be the leading route of virus delivery to liberate a virus genome