EMB plates incubated overnight at 37° C. Metallic

EMB plates incubated overnight at 37° C. Metallic green sheen colonies in EMB plates were considered as presumptive E. coli and gloppy black colonies with a green metallic K.Pneumoniae .Gram-negative bacilli, motile strains with Methyl red and Indole positive (+), and Voges – Proskauer and Citrate utilization (-) and also which can ferment most of the sugar were presumptively considered as E. coli and  Methyl red and Indole negative (-), and Voges – Proskauer and Citrate utilization (+) K. pneumonia. All E. coli & K. pneumonia isolates were sub cultured on Luria agar & stored in stab culture as well as 20% glycerol stock at -80° C for long time storage.

3.2.9 Maintenance of Cultures

3.2.9.1 Glycerol stock

Those colonies which were considered as presumptive E. coli & K. Pneumonia were transferred to Luria broth which is also referred to as Lysogeny broth (nutrient-rich medium that allows rapid and robust growth of bacteria) (Hi Media, Mumbai, India) and incubated overnight at 37° C, then 20% Glycerol on 0.5 ml of log culture of bacteria in sterile 1.5 ml test tubes. The two were mixed properly by help of vortex to ensure even distribution. The culture were kept at -80° C for long time storage and further experiments. The process was done according to the protocol described by Sam brook et al., 1989.

3.2.9.2 Stab culture

Sterlized polypropylene vial of 5 ml capacity were filled to two-thirds with molten sterile Luria agar Annexure-A medium. After solidifying, bacterial culture was picked up from Luria broth with the help of inoculation needle and stabbed through the agar. Incubated at 37° C for 18 hours and kept at 4° C for storage. Colonies were confirmed as E. coli & K. pneumonia using biochemical test such as Indole test, Methyl Red test, Voges – Proskauer test and Citrate utilization test. Subsequently, these strains were tested 16Sr RNA and their tolerance to antibiotic resistance and were used for further research exploitation.

            3.2.10 Biochemical characterization of E. coli & K. pneumonia isolates

The IMViC tests are a group of individual tests used in microbiology laboratory testing to identify an organism in the coliform group. A coliform is a gram negative, aerobic or facultative anaerobic rod which produces gas from lactose fermentation within 48 hours. The presence of some coli forms indicate fecal contamination. Except for the lowercase “i”, which is added for ease of pronunciation, each of the letters in “IMViC” stands for one of these tests. “I” is for Indole; “M” is for Methyl red; “V” is for Voges – Proskauer, and “C” is for Citrate (Table 8). These IMViC tests are useful for differentiating bacteria of the family Enterobacteriaceae. E. coli & K. pneumonia isolates were confirmed by IMViC tests, Indole test (to determine the ability of the organism to split indole from the amino acid tryptophan), Methyl-red test (to tests for an evidence of an enteric bacterium). The reaction was developed by Daniel Wilhelm Otto Voges and Bernhard Proskauer, German bacteriologists in 1898 t the Institute for Infectious Diseases, and Citrate utilization test (to check the ability of an organism to use citrate as the sole source of carbon and energy).

3.2.8.1 Indole test

Five drops of Kovac’s reagent Isoamyl alcohol, Paradimethylaminobenzaldehyde, concentrated hydrochloric acid) was added into 2 days old growth of the isolate in 2 ml of Peptone water. A positive result is shown by the presence of a red-pink color in the surface alcohol layer of the broth. A negative result appears Yellow. E. coli is an Indole-Positive bacteria.

3.2.8.2 Methyl- Red (MR) test

Five to six drops of pH indicator Methyl red (MR) reagent was added into a 2 to 5 days growth of the isolate in 3 ml of Glucose-Phosphate Peptone Water. Tube was gently rolled between the palms of the hands to disperse the Methyl red. Enteric that subsequently metabolize pyruvic acid to other acids lower the pH of the medium to 4.2. At this pH, Methyl red turns red. A red color represents a positive test. A yellow color represents a negative a negative test. E.coli is Methyl red-Positive bacteria.

3.2.8.3 Voges-Proskauer (VP) test (Barritt’s Method)

First, 3 ml of 5% solution of ?-naphthol in absolute ethanol, then 1 ml of 40% Potassium Hydroxide (KOH) was added to a five days growth of the isolate in five ml of Glucose-Phosphate Peptone water. A cherry red color indicates a positive result, while a yellow-brown color indicates a negative result. E.coli is VP Negative organisms.

3.2.8.4 Citrate Utilization

Slant of Simmons’ citrate agar (Hi Media, Mumbai, India) was inoculated with the presumptive E. coli & K. pneumonia culture and incubated at 37° C for seven days. Growth on the medium without color change is considered as Negative and growth with a development of blue color of the medium is considered as Positive. E. coli is a Citrate Negative organisms.

3.2.11 DNA Extraction from E. coli & K. pneumonia

         To carry out this research we used two different method of isolation genomic DNA for  

           detection of antibiotic resistance genes. First of all, Boiling method used for isolation of    

DNA and after checking the quantity and quality of yielded DNA by running the agarose gel. Run gel for PCR, if we get any specific PCR product band, we go for two other protocols for preserving DNA for long time. Boiling method has some advantages and disadvantages; advantages such as its rapid and less expensive and it gets whole DNA and main disadvantage of Boiling method is that it can’t be kept it for long time (maximum one week). The DNA extraction was set up according to the protocol described by Sam brook et al., 2009.

Boiling method protocol for isolation of DNA

1) 1.5 ml culture is spinned at 8000 rpm for 10 minutes.

2) Discard supernatant in discard bottle (because contain bacteria).

3) Dissolve pellet in 200 µl 1x PBS.

4) Vortex it slightly until pellet dissolves in solution.

5) Centrifuge at 8000 rpm for 10 minutes.

6) Discard supernatant.

7) Dissolve pellet in 200 µl 1x PBS.

8) Centrifuge at 8000 rpm for 10 minutes.

9) Dissolve pellet in 100 µl MilliQ water. 

           10) Boil for 10 minutes, then keep it at room temperature for 10 minutes

           11) Took upper portion for 40 µl.

           12) Store at -20° C (maximum for one week).

In next process, we carry DNA isolation with two different protocol for genomic (Phenol, Chloroform, Isoamyl alcohol) and Plasmid (Plasmid “mini-prep”) to keep DNA for long time for further experiments.

3.2.11.1 Genomic DNA isolation from bacterial cells by PCI method

         The Genomic DNA isolation process described by Sam brook et al., 1989.

1.      Centrifuge the overnight (fresh) culture at 13000 rpm for 10 minutes, and discard     supernatant carefully.

2.      Adding 20µl of cell lysis and vortex it, then add 20µl of proteinase K (50µg/ml) and   

vortex it slightly.

3.      Incubate at 55° C for 90 minutes in water bath (micro tubes should sealed by parafilm).

4.      Add 220µl of PCI solution (saturated Phenol: chloroform: Isoamyl alcohol; 25:24:1)   and then mix it between palms.

5.      Centrifuge at 13000 rpm for 15 minutes and take upper layer to new micro tubes.

6.      Step 4 and 5 is repeated again for a second time.

7.      Add equal amount of Chloroform to upper layer.

8.      Centrifuge at 13000 rpm for 15 minutes and collect aquous phase and transfer to new micro tubes.

9.      Add double volume of Chilled absolute ethanol.

10.  Leave it overnight in -20° C refrigerator (we also can keep it just for 1-2 hours).

11.  Centrifuge it at 13000 rpm for 20 minutes to obtain DNA pellet, discard the supernatant.

12.  Add 300 µl of ice-cold 70% ethanol for washing the pellet.

13.  Centrifuge the microtubes at 13000 rpm for 10 minutes.

14.  Carefully pour off ethanol.

15.  Allow it to dry for 30-45 minutes at 37° C (in incubator).

16.  Add 50µl of hydration buffer (1x MilliQ TE).

17.  Allow it to rehydrate at room temperature for 10 minutes.

18.  Store in 4° C refrigerator.

19.  Next day run on 0.8% agarose gel for checking the quality and quantity of DNA.

3.2.11 Equilibrate of Phenol

·         Phenol used to remove protein from nucleic acid in chromosomal DNA isolation.

·         Cell extraction such as Organic-phenol, CHCl3; high salt; guanidinium HCl.

·         Remove of cell debris such as Proteins, Lipids, Polysaccharides.

·         Concentration of DNA such as Ethanol, Isopropanol; DNA absorbing matrix; CTAB, Sperm dine.

Stepwise procedure to equilibrate phenol.

1.      Heat a water bath to 65° C and place the bottle of phenol in the 65° c water bath to

melt the crystals.

           2.  Add 8-hydroxyquinoline to a final concentration of 0.1% w/v to the phenol. Mix to

                dissolve the 8-hydroxyquinoline.

           3.  Add an equal volume of 1M Tris-HCL (pH 8.0) to the phenol. Mix for 15 minutes.

                Return the bottle to the 65° C water bath. Allow the phases to separate. Siphon off the

                top layer and discard.

           4.  Repeat the procedure as in Step 3 twice.  

           5.  Add an equal volume of 0.5M Tris-HCL (pH 8.0) to the phenol.

                Repeat the procedure as in step 3.

          6.  Repeat the extractions with 0.5M Tris-HCL (pH 8.0) until the aqueous phase is pH 7.8

               (measure with pH meter). Repeat the procedure as in Step 3. Leave approximate 1 cm

              cm layer of 0.5M Tris-HCL (pH 8.0) over the phenol. Add 2-mercaptoethanol to a final

             concentration of 0.2% w/v to the 0.1M Tris HCL (pH 8.0).

         7. The buffer saturated phenol may be stored at 4°C for 1 month for DNA extraction. Test

             the pH periodically and do not use if the pH is <  7.5. Note: Phenol will be lost during the preparation of the buffer saturated phenol. Start with             at least 2.5x the final volume of phenol that you will need.             3.2.11.3 PCR amplification of 16srRNA                         Oligonucleotide primers Dideoxyoligonucleotide primers (Table 5) used in this study to amplify 16SrRNA was prepared from Published Primer (ACCESSION No. (KR350501) Oligo Name Length (bp) Primer Sequence (5'- 3)   Forward Primer       20 ACATGCAAGTCGAACGGTAACA Reverse Primer       20 GCACCTGAGCGTCAGTCTTC                             Table : 5 Custom dideoxyoligonucleotide primers used in this study             3.2.11.4 Genetics of AMR detoxification system The genes for antibiotic resistance can be present on plasmids as well as chromosomes. In the present study genes on plasmids and chromosomes for antibiotic resistance has been studied. To find out the location of genetic determinants, the following experiments were carried out. For all the experiments, Milli-Q water was used. All reagents solution, media, Eppendrof tubes, and tips were sterilized at 15psi for 20 minutes in an autoclave. After an initial hot start at 95°c for 5 minutes, amplification was carried out for 30 cycles with each cycle consisting of a denaturation step (94°C, 30 seconds), an annealing step (65°C, 30 seconds) and an extension step (72°C, 45 seconds). To enable the reaction to go to completion, after the last cycle, the extension was continued for a further 10 minutes. 3.2.11.5 Agarose Gel Electrophoresis Agarose gel electrophoresis was carried out on 1% agarose in TBE buffer. The agarose was dissolved by boiling in microwave oven in 0.5x TBE buffer. The solution was cooled to approximately 40° C, the reason for allowing the agarose to cool a little before adding EtBr is to minimize production of ethidium bromide vapor, then add Ethidium Bromide as 2 µl per 100ml of solution and poured to a depth of about 5 mm into the casting tray with  comb, comb teeth are about 1-2 mm above the surface of tray. Leave gel to set for at least 30 minutes, preferably 1 hour, After the gel was set, the comb was removed (the gel may look set much sooner but running DNA into a gel too soon can give terrible looking result with smeary diffuse bands) and gel was placed in an electrophoresis tank containing 0.5x TBE buffer. The samples were mixed with the loading dye (Bromophenol blue) at the ratio of 5:2, respectively and were loaded into the slot of submerged gel, the dyes are negatively charged in neutral buffers and thus move in the same direction as the DNA during electrophoresis. The gel was run by applying 3 volt/cm until the due come out of the wells then increasing the voltage upto 5 volt/cm for the desired time. The gel was stopped when the Bromo Phenol Blue (BPB) has run ¾ the length of the gel. The gel was checked by transilluminator which has UV light of wavelength 254 nm. Then photo was taken using Gel Doc (Gel Documentation System, Gel Image System or Gel Imager), which is widely used in molecular biology laboratories for the imaging and documentation of nucleic acid agarose gels typically stained with ethidium bromide. Generally, a Gel Doc is composed of an ultraviolet(UV) light transilluminator, a hood to shield external light sources and a camera for image capturing. 3.2.11.6 Sequencing DNA sequencing is the process of determining the precise order of nucleotide within a DNA molecule. It includes any method or technology that is used to determine the order of the four bases adenine, guanine, cytosine and thymine., in a strand of DNA. The advent of rapid DNA sequencing methods has greatly accelerated biological and medical research and discovery. Knowledge of DNA sequences has become indispensable for basic biological research, and in numerous applied fields such as diagnostic, biotechnology, forensic biology, and biological systematic. The sequencing of desired genes of Enteroaggregative E. coli was done by sending PCR products and primers to MACROGEN company in South Korea and we had done sequencing. 3.2.11.7 Alignment of Nucleotide Sequences Alignment of nucleotide sequences, genetic distance and phylogenic tree were calculated and constructed with the CLUSTALW  programme. 3.2.11.8 Phylogenetic Tree After multiple Sequence alignment the Phylogenetic tree was drawn, as we know that phylogram is a branching diagram (tree) assumed to be an estimate of a phylogeny, branch lengths are proportional to the amount inferred evolutionary change; on the other hand, cladogram is a branching diagram (tree) assumed to be an estimate of a phylogeny where the branches are of equal length, thus cladograms show common ancestry, but do not indicate the amount of evolutionary "time" separating taxa. The method used during study was NJ (Neighbour Joining) method. 3.2.12 Assay for Antimicrobial Susceptibility pattern Test (AST) of the                E. coli & K. pneumonia isolates   Disc diffusion methods are suitable for organism that grow rapidly overnight at 35-37° C. The antibiotic impregnated discs absorb moisture from the agar and antibiotic diffuses into the agar medium. The rate of extraction of antibiotic from the disc is greater than the rate of diffusion. As the distance from the disc increase, there is a logarithmic reduction in the antibiotic concentration. The extent of antimicrobial diffusion is affected by the depth of the agar. Visible growth of bacteria occurs on the surface of the agar where the concentration of antibiotic has fallen below its inhibitory level for the test strain. All E. coli & K. pneumonia from isolated water sample were analyzed for their Antimicrobial Susceptibility pattern test (AST) by Kirby – Bauer method. 3.2.12.1 Material & Media Luria Broth, Muller Hinton agar (Hi Media, Mumbai, India), Barium Sulphate Turbidity standard, Antibiotic discs. 3.2.12.2 Medium for AST   The medium must support good overnight growth of test and control organisms; slow growth can result in the inhibition zones being abnormally large. The pH of the medium must be close to 7.3. The medium used was Muller Hinton agar (MHA) and was prepared exactly according to the manufacturer's instruction and poured to a depth of 4 mm (25ml medium) in flat-bottomed 9 cm sterile Petri dishes on a leveled surface. 3.2.12.3 Inoculum The ideal inoculum after overnight incubation gives an even semi-confluent growth. The inoculum was prepared from material picked up with a loop from five to ten colonies of the species to be tested. This material was suspended in saline or broth, or grown as an overnight culture in broth. The suspension or culture was then be diluted to yield the correct weight of inoculum. The density of the suspension to be inoculated was measured by comparison with an opacity standard. e.g. a barium sulphate suspension (Mc Farland standard). Control inoculum was spread in two bands on either side of the plate, leaving a central band uninoculated. The test organism was inoculated onto the central area of the plate in a similar manner. An uninoculated gap 2-3 mm wide should separate the test and control areas. 3.2.12.4 Preparation of Barium Sulphate Turbidity standard To standardize the inoculum density for a susceptibility test, a BaSo4 turbidity standard, equivalent to a 0.5 McFarland standard or its optical equivalent (e.g., latex particle suspension) should be used. A BaSo4 0.5 McFarland standard prepared as follows: 1.      A 0.5 ml aliquot of 0.048 mol/L BaCl2 (1.175%) w/v BaCl2.2H2O) was added to 99.5 ml of 0.18 mol/L H2SO4 (1%  v/v) with constant stirring to maintain a suspension. 2.      The correct density of the turbidity standard was verified by using a spectrophotometer with a 1 cm light path and matched cuvette to determine the absorbance. The absorbance at 625 nm should be 0.008 to 0.10 for the 0.5 McFarland standard. 3.      The barium sulphate suspension were transferred in 4 to 6 ml aliquots into screw-cap tubes of the same size as those used in growing or diluting the bacterial inoculum. These tubes were tightly sealed and stored in dark at room temperature. 4.      The barium sulphate turbidity standard was vigorously agitated on a mechanical vortex mixer before each use and inspected for a uniformly turbid appearance. If large particles appear, the standard should be replaced. The barium sulphate standard should be replaced or their densities verified monthly.             3.2.12.5 Antibiotic Resistance Test               Disk diffusion method The antibiotic resistance patterns of the wild-type E.coli & K. pneumonia strains were determined qualitatively from the zones of inhibition around antibiotic disks placed equidistant on plates on Mueller Hinton Agar medium spread with the organism. 3.2.12.6 Antibiotic discs Commercially prepared discs 6 mm in diameter should be used. Discs and dispensers should be stored in sealed containers with a desiccant, bulk stock being kept at -20° C if possible. Before they are opened for use, the container should be allowed to warm up slowly at room temperature to minimize condensation of moisture, which may lead to hydrolysis of the antibiotic. Discs should be applied to plates so that close even contact is made with the medium. Avoid leaving inoculated plates at room temperature before applying discs, as bacteria may multiply and thus give smaller zone size.             3.2.12.7 Choice of drug for tests The drugs to be tested against antibiotic resistant E. coli & K. pneumonia were grouped in set of six the maximum number that could be accommodated on a single 9cm diameter plate. So, we did this test in 2 plates. Commercially available following antibiotic discs (Hi Media, Mumbai, India) were used for antibiotic susceptibility test: Ceftazidime (30mcg), cefotaxime (30mcg), Cefpodoxim (10mcg), Azithromycin(15mcg), Metronidazole(4mcg), (Meropenem(10mcg), Amikacin(30mcg), Ampicillin (10mcg), Ceftriaxone (30mcg), and  Ciprofloxacin (5mcg). Cephalosporin (30mcg) alone Cefotaxime (30mcg), Ceftazidime (30mcg), Cefepime (30mcg), Cefepirome (30mcg) and in combination with clavulanic acid (10mcg). 3.2.12.8 Procedure for performing the disk diffusion test Inoculum preparation done by growth method, The growth method was performed as follows: 1.      Top of selected single colony from Luria agar plate was touched with a loop and transferred into a tube containing of Luria broth medium. 2.      The broth culture was incubated at 37° C until it achieves or exceeds the turbidity of the 0.5 McFarland standard (usually 3 to 4 hours). Rowing broth culture was adjusted with sterile saline or broth to obtain turbidity optically comparable to that of the 0.5 McFarland standard. 3.      The turbidity of the actively growing broth culture was adjusted with sterile saline or broth to obtain turbidity optically comparable to that of the 0.5 Mc Farland standard. 3.2.12.9  Inoculation of plates and application of discs of inoculated Agar Optimally, within 15 minutes after adjusting the turbidity of the inoculum suspension, a sterile cotton swab was dipped into the adjusted suspension. The swab should be rotated several times and pressed firmly on the inside wall of the tube above the fluid level. This will remove excess inoculum from the swab. The dried surface of Muller Hinton agar plate was inoculated by streaking the swab over the entire sterile agar surface. This procedure was repeated by streaking two more times rotating the plate approximately 60° each time to ensure an even distribution of inoculum. As a final step, the rim of the agar was swabbed. The inoculum was left to dry for few minutes at room temperature with lid closed. Ten antibiotic discs were placed into two different plates (90 mm) evenly (approximately 15 mm) from the edge of plate) by help of forceps and slightly pressed to fix on agar surface. Each plate had five antibiotic discs, so two plates for each sample were required. 3.2.13 Incubation Plates will be incubated in air at 35-37° C overnight (ideally for 16-18h) in inverted position within 15 minutes after the discs were applied. 3.2.13.1 Reading and reporting results The inhibition zones of the control strain is measured, the distance in millimeters from the edge of the disc to the zone edge if that is obvious; if it is not, measure to the point of 80% inhibition of growth. The measurement will be made with calipers, a millimeter rule or a ruled template, but we measured it by antibiotic zone scale (Hi Media, Mumbai, India) and on the agar surface, not through the glass or plastic bottom or lid of the dish. If the size of the inhibition zones of the test strains is as large as or larger than those of the control strain, or if growth reaches to the disc's edge, sensitivity or resistance is unequivocal and zone sizes do not need to be measured. Strain will be classified as